SubtiBank SubtiBank
ganQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ganQ

galactotriose [SW|ABC transporter] (permease)
locus
BSU_34140
pI
9.76
mw
31.15 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
function
uptake of galactotriose
product
galactotriose [SW|ABC transporter] (permease)
essential
no
synonyms
yvfM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.24|Utilization of galactan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,505,102 3,505,953

    Phenotypes of a mutant

  • a ''[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]'' mutant is impaired in the utilization of galactan [Pubmed|22893383]
  • The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|MdxG]
  • Structure

  • [PDB|2R6G] (from E. coli, 34% identity) [pubmed|18033289]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]
    description
    [Pubmed|9287030]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|27501980], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [Pubmed|9287030], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|28617843], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843,27501980]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|28617843,27501980]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A486 (yvfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/486 NBRP B. subtilis, Japan]
  • BKE34140 ([gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATATCTGCCAGCA, downstream forward: _UP4_GGCTAAGAGAACAAGGAGGA
  • BKK34140 ([gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATATCTGCCAGCA, downstream forward: _UP4_GGCTAAGAGAACAAGGAGGA
  • References

  • 10092453,9287030,22893383,27501980,18033289