SubtiBank SubtiBank
sacT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sacT

transcriptional antiterminator for the [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA] operon
locus
BSU_38070
pI
5.59
mw
31.92 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
regulation of sucrose utilization
product
transcriptional antiterminator
essential
no
synonyms
ipa-47d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.9|Phosphoproteins / Other]
  • Gene

    Coordinates
    3,906,142 3,906,972

    The protein

    Catalyzed reaction/ biological activity

  • binding to the mRNA of the ''[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'' operon, causes transcription antitermination (in presence of sucrose and absence of glucose)
  • Protein family

  • [SW|PRD-containing transcription factors]
  • Paralogous protein(s)

  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY], [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]
  • [SW|Domains]

  • N-terminal RNA binding domain [Pubmed|10610766]
  • 2 x [SW|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] regulation domains) [Pubmed|9663674]
  • Modification

  • Phosphorylated and inactivated by [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP] (EIIScr) (according to Swiss-Prot)
  • Structure

  • [PDB|1TLV] (the [SW|PRD] domains of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], corresponds to aa 54 ... 271, 41% identity) [pubmed|15699035]
  • Expression and Regulation

    Operons

    genes
    [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    genes
    [gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]-[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • GP429 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
  • BKK38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
  • Expression vectors

  • for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP166, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP426, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP427, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP439, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP440, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP571, available in [SW|Jörg Stülke]'s lab
  • for expression of RNA-binding domain in ''B. subtilis'', in [SW|pBQ200]: pGP446, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with C-terminal Strep-tag, in [SW|pGP382]: pGP1064, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with N-terminal Strep-tag, in [SW|pGP380]: pGP1068, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1227 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1223 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 9663674,18086213
  • Original publications

  • 12107147,2163394,1577686,8702561,1279678,21278164,26020636,22383849,15699035