SubtiBank SubtiBank
bmrC
The papers of the month are back! Check them out! Link here

bmrC

multidrug [SW|ABC transporter ](ATP-binding protein), also involved in the signalling pathway to activate [protein|search|KinA ]at the onset of [SW|sporulation]
locus
BSU09710
pI
6.25
mw
64.94 kDa
protein length
585 aa Sequence Blast
gene length
1755 bp Sequence Blast
function
multiple antibiotic resistance
product
multidrug [SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms
yheI

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.1|Efflux of antibiotics]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.3|Regulatory ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,045,318 → 1,047,075

    The protein

    [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]-[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]
    description
    [Pubmed|25217586]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,25217586], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB]: attenuation, [Pubmed|25217586], in [regulon|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB regulon]
  • regulation

  • ''[protein|search|bmrB]-[protein|search|bmrC]-[protein|search|bmrD]'' expression only occurs during the late-exponential and stationary growth stages ([protein|search|AbrB]) [Pubmed|25217586]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B490 (yheI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1489 NBRP B. subtilis, Japan]
  • BKE09710 (Δ[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCCCCATCTCCTCA, downstream forward: _UP4_GCGGAAGAAGGGGGAGCAGG
  • BKK09710 (Δ[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCCCCATCTCCTCA, downstream forward: _UP4_GCGGAAGAAGGGGGAGCAGG
  • References

  • 19167342,10092453,16487324,25217586,21602923,29507890