SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


multidrug [SW|ABC transporter ](ATP-binding protein), also involved in the signalling pathway to activate [protein|search|KinA ]at the onset of [SW|sporulation]
64.94 kDa
protein length
585 aa Sequence Blast
gene length
1758 bp Sequence Blast
multiple antibiotic resistance
multidrug [SW|ABC transporter ](ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Efflux of antibiotics]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Regulatory ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,045,318 1,047,075

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|YknU], [protein|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|YknV], [protein|D5A3C316BD4567A0155F70330E32ACDE18F063FE|YwjA], [protein|E85814EDF232D21A42380D559EAD2CDFB41F19DB|YfiC], [protein|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|BmrA], [protein|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|YgaD], [protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|YfiB]
  • [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • Structure

  • [PDB|5MKK] (TmrAB complex from Thermus thermophilus, 35% identity) [pubmed|28069938]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,25217586], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB]: attenuation, [Pubmed|25217586], in [regulon|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB regulon]
  • regulation

  • ''[protein|search|bmrB]-[protein|search|bmrC]-[protein|search|bmrD]'' expression only occurs during the late-exponential and stationary growth stages ([protein|search|AbrB]) [Pubmed|25217586]
  • view in new tab

    Biological materials


  • MGNA-B490 (yheI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09710 ([gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCCCCATCTCCTCA, downstream forward: _UP4_GCGGAAGAAGGGGGAGCAGG
  • BKK09710 ([gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCCCCATCTCCTCA, downstream forward: _UP4_GCGGAAGAAGGGGGAGCAGG
  • References

  • 19167342,10092453,16487324,25217586,21602923,29507890,28069938