SubtiBank SubtiBank
ywjB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywjB

unknown
locus
BSU_37220
pI
4.53
mw
19.44 kDa
protein length
174 aa Sequence Blast
gene length
525 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,819,220 3,819,744

    The protein

    Structure

  • [PDB|2GD9] ([protein|E2CABD337831904871E0F0260DAA992E41A4F9E0|YyaP], 31% identity)
  • [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]-[gene|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA]-[gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    genes
    [gene|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA]-[gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • repressed unless the cells enter an iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B661 (ywjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1660 NBRP B. subtilis, Japan]
  • BKE37220 ([gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCTCCTATCGAT, downstream forward: _UP4_TAAGAAAAAGGATAGACAGA
  • BKK37220 ([gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCTCCTATCGAT, downstream forward: _UP4_TAAGAAAAAGGATAGACAGA
  • References

  • 12354229,9353933