SubtiBank SubtiBank
yvaG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvaG

similar to 3-oxoacyl- acyl-carrier protein reductase
locus
BSU_33590
pI
4.76
mw
28.86 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,449,732 3,450,526

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0FD332269D2D6103E57ACE719E39977C68E38F0A|YvrD]
  • Structure

  • [PDB|3T4X] (from ''B. anthracis'', 80% identity, 96% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|687EB1E57D116F6D3A1F9A65505E1A069F34DC82|yvaG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A450 (yvaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/450 NBRP B. subtilis, Japan]
  • BKE33590 ([gene|687EB1E57D116F6D3A1F9A65505E1A069F34DC82|yvaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTCATCCCTCCGTTT, downstream forward: _UP4_TAAACCTCTCCCAATAGGAG
  • BKK33590 ([gene|687EB1E57D116F6D3A1F9A65505E1A069F34DC82|yvaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTCATCCCTCCGTTT, downstream forward: _UP4_TAAACCTCTCCCAATAGGAG