SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


lysine-8-amino-7-oxononanoate aminotransferase
49.95 kDa
protein length
448 aa Sequence Blast
gene length
1344 bp Sequence Blast
biosynthesis of biotin
lysine-8-amino-7-oxononanoate aminotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • Gene

    3,093,343 → 3,094,689

    The protein

    Catalyzed reaction/ biological activity

  • 8-amino-7-oxononanoate + L-lysine --> (S)-2-amino-6-oxohexanoate + 7,8-diaminononanoate (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|YhxA]:
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3DRD]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • BKE30230 (Δ[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATGAGTCATGATCTTC, downstream forward: _UP4_AGCCTTGAAGATTGATTCCT
  • BKK30230 (Δ[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATGAGTCATGATCTTC, downstream forward: _UP4_AGCCTTGAAGATTGATTCCT
  • References


  • 21437340
  • Original publications

  • 8763940,15880481,8892842