SubtiBank SubtiBank
bioA

bioA

lysine-8-amino-7-oxononanoate aminotransferase
locus
BSU_30230
pI
5.32
mw
49.95 kDa
protein length
448 aa Sequence Blast
gene length
1344 bp Sequence Blast
function
biosynthesis of biotin
product
lysine-8-amino-7-oxononanoate aminotransferase
essential
no
ec
2.6.1.62
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.1|Biosynthesis/ acquisition of biotin]
  • Gene

    Coordinates
    3,093,343 → 3,094,689

    The protein

    Catalyzed reaction/ biological activity

  • 8-amino-7-oxononanoate + L-lysine --> (S)-2-amino-6-oxohexanoate + 7,8-diaminononanoate (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|YhxA]:
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3DRD]
  • Expression and Regulation

    Operons

    genes
    [gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]-[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]-[gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]-[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]-[gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]-[gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]-[gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]
    description
    [Pubmed|8763940,8892842]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials

    Mutant

  • BKE30230 (Δ[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATGAGTCATGATCTTC, downstream forward: _UP4_AGCCTTGAAGATTGATTCCT
  • BKK30230 (Δ[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATGAGTCATGATCTTC, downstream forward: _UP4_AGCCTTGAAGATTGATTCCT
  • References

    Reviews

  • 21437340
  • Original publications

  • 8763940,15880481,8892842