SubtiBank SubtiBank
ydgB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydgB

unknown
locus
BSU_05570
pI
3.49
mw
9.32 kDa
protein length
gene length
273 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    602,441 602,713

    Expression and Regulation

    Operons

    genes
    [gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]-[gene|483587EB658850D786C3C95C02D419994FCC9F45|ydgA]-[gene|8F85E6DE353F29759301A463335BFC15F829E2D0|cotP]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|9068633], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC]) [Pubmed|15699190]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-C173 (ydgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2171 NBRP B. subtilis, Japan]
  • BKE05570 ([gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACACCCTTCCA, downstream forward: _UP4_ATTTTAGATTAAAGGGGTTT
  • BKK05570 ([gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACACCCTTCCA, downstream forward: _UP4_ATTTTAGATTAAAGGGGTTT
  • References

  • 15699190,9068633,11150673