SubtiBank SubtiBank
glnA
The papers of the month are back! Check them out! Link here

glnA

glutamine synthetase, trigger enzyme
locus
BSU17460
pI
4.87
mw
50.11 kDa
protein length
444 aa Sequence Blast
gene length
1332 bp Sequence Blast
function
glutamine biosynthesis, control of [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA] and [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR] activity
product
glutamine synthetase, trigger enzyme
essential
no
ec
6.3.1.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.2|Trigger enzymes that control gene expression by protein-protein interaction with transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    1,878,425 → 1,879,759

    Phenotypes of a mutant

  • auxotrophic for glutamine
  • The protein

    Catalyzed reaction/ biological activity

  • ATP L-glutamate NH3 = ADP phosphate L-glutamine (according to Swiss-Prot)
  • Protein family

  • glutamine synthetase family (according to Swiss-Prot)
  • Kinetic information

  • K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 µmol/min/mg
  • [SW|Domains]

  • glutamate binding flap (aa 300 ... 306: protects unstable intermediates from abberant hydrolysis)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-26, Thr-147, Ser-207, and Thr-286 [Pubmed|20389117]
  • [SW|Cofactors]

  • Mg(2 )
  • Effectors of protein activity

  • feedback inhibition by glutamine, glutamine binds the entrance site for glutamate
  • activity is inhibited upon interaction with [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA] [Pubmed|23535029]
  • Structure

  • [PDB|4LNN] (apo-GS) [Pubmed|24158439]
  • [PDB|3QAJ] (complex with ATP)
  • [http://pdb.org/pdb/search/structidSearch.do?structureId=4s0r 4S0R] (the [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]-[protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] complex) [Pubmed|25691471]
  • [PDB|A general discussion of GS structure]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • GlnA is a homooligomer of 12 subunits
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
    description
    [Pubmed|8636055]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2906311], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, in complex with [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • regulation

  • expressed in the absence of glutamine ([protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]) [Pubmed|8636055]
  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|9F6B78C1932FB56F7F71430DB16BC862A312407B|ynbA]-[gene|14EFA3BF4E5DD5368EF02B0733300CEF7A4E0DC7|ynbB]-[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
    description
    [Pubmed|22383849]

    regulation

  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • GP247 (''glnA::cat''), available in [SW|Jörg Stülke]'s lab
  • BKE17460 (''glnA''::''ermC'') (available at the [http://www.bgsc.org/ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP2263 (''glnA''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • BP148 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''cat''), available in [SW|Fabian Commichau]'s lab
  • GP1883 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''ermC''), available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs
  • BKE17460 (Δ[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
  • BKK17460 (Δ[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
  • Expression vector

  • expression/ purification from ''E. coli'', with N-terminal Strep-tag (in [SW|pGP172]): pGP174, available in [SW|Jörg Stülke]'s lab
  • pGP177 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • ''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-lacZ'': pGP189 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Karl Forchhammer]'s lab
  • Labs working on this gene/protein

  • [SW|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]
  • References

    Reviews

  • 10231480,18086213,22625175
  • Original publications

  • 19233925,20389117,8799114,18195355,11719184,12139611,2573733,8636055,19233925,16493705,16885465,6141156,2906311,20656908,16055443,25755103,18331450,16547045,8093698,21435182,23535029,24158439,15378759,25691471,26635369,26883633,29794222