SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glutamine synthetase, trigger enzyme
50.11 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
glutamine biosynthesis, control of [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA] and [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR] activity
glutamine synthetase, trigger enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes that control gene expression by protein-protein interaction with transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    1,878,425 1,879,759

    Phenotypes of a mutant

  • auxotrophic for glutamine
  • The protein

    Catalyzed reaction/ biological activity

  • ATP L-glutamate NH3 = ADP phosphate L-glutamine (according to Swiss-Prot)
  • Protein family

  • glutamine synthetase family (according to Swiss-Prot)
  • Kinetic information

  • K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 mol/min/mg
  • [SW|Domains]

  • glutamate binding flap (aa 300 ... 306: protects unstable intermediates from abberant hydrolysis)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-26, Thr-147, Ser-207, and Thr-286 [Pubmed|20389117]
  • [SW|Cofactors]

  • Mg(2 )
  • Effectors of protein activity

  • feedback inhibition by glutamine, glutamine binds the entrance site for glutamate
  • activity is inhibited upon interaction with [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA] [Pubmed|23535029]
  • Structure

  • [PDB|4LNN] (apo-GS) [Pubmed|24158439]
  • [PDB|3QAJ] (complex with ATP)
  • [ 4S0R] (the [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]-[protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] complex) [Pubmed|25691471]
  • [PDB|A general discussion of GS structure]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • GlnA is a homooligomer of 12 subunits
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2906311], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, in complex with [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • regulation

  • expressed in the absence of glutamine ([protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]) [Pubmed|8636055]
  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab



  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • GP247 (''glnA::cat''), available in [SW|Jörg Stülke]'s lab
  • BKE17460 (''glnA''::''ermC'') (available at the [ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP2263 (''glnA''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • BP148 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''cat''), available in [SW|Fabian Commichau]'s lab
  • GP1883 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''ermC''), available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs
  • BKE17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
  • BKK17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
  • Expression vectors

  • expression/ purification from ''E. coli'', with N-terminal Strep-tag (in [SW|pGP172]): pGP174, available in [SW|Jörg Stülke]'s lab
  • pGP177 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • ''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-lacZ'': pGP189 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Karl Forchhammer]'s lab
  • labs

  • [SW|Susan Fisher], Boston, USA [ homepage]
  • References


  • 10231480,18086213,22625175
  • Original publications

  • 19233925,20389117,8799114,18195355,11719184,12139611,2573733,8636055,19233925,16493705,16885465,6141156,2906311,20656908,16055443,25755103,18331450,16547045,8093698,21435182,23535029,24158439,15378759,25691471,26635369,26883633,29794222