SubtiBank SubtiBank
yojI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yojI

similar to multidrug efflux transporters
locus
BSU_19440
pI
9.78
mw
49.09 kDa
protein length
452 aa Sequence Blast
gene length
1359 bp Sequence Blast
function
unknown
product
putative multidrug exporter
essential
no
synonyms
norM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.15|Multidrug exporters/ based on homology]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,119,393 2,120,751

    The protein

    Protein family

  • [SW|MOP exporter family]
  • [SW|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (according to UniProt)
  • Structure

  • [PDB|3MKT] (multidrug exporter from Vibrio cholerae, 37% identity) [pubmed|20861838]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]-[gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B427 (yojI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1426 NBRP B. subtilis, Japan]
  • BKE19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC, downstream forward: _UP4_CACATTTAAAAGAGGTGATC
  • BKK19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC, downstream forward: _UP4_CACATTTAAAAGAGGTGATC
  • References

    Research papers

  • 20861838