SubtiBank SubtiBank
yojI [2019-06-27 13:11:22]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yojI [2019-06-27 13:11:22]

similar to multidrug efflux transporters
49.09 kDa
protein length
452 aa Sequence Blast
gene length
1359 bp Sequence Blast
putative multidrug exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Multidrug exporters/ based on homology]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,119,393 2,120,751

    The protein

    Protein family

  • [SW|MOP exporter family]
  • Structure

  • [PDB|3MKT] (multidrug exporter from Vibrio cholerae, 37% identity) [pubmed|20861838]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B427 (yojI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC, downstream forward: _UP4_CACATTTAAAAGAGGTGATC
  • BKK19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC, downstream forward: _UP4_CACATTTAAAAGAGGTGATC
  • References

    Research papers

  • 20861838