SubtiBank SubtiBank
rhaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhaB

rhamnulokinase
locus
BSU_31200
pI
5.42
mw
54.57 kDa
protein length
485 aa Sequence Blast
gene length
1458 bp Sequence Blast
function
utilization of rhamnose
product
rhamnulokinase
essential
no
ec
2.7.1.5
synonyms
yulC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.12|Utilization of rhamnose]
  • Gene

    Coordinates
    3,199,565 3,201,022

    The protein

    Catalyzed reaction/ biological activity

  • ATP L-rhamnulose = ADP L-rhamnulose 1-phosphate [Pubmed|26712933]
  • Protein family

  • rhamnulokinase family (single member, according to UniProt)
  • Structure

  • [PDB|2UYT] (the enzyme of ''E. coli'')
  • Expression and Regulation

    Operons

    genes
    [gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
    description
    [Pubmed|26712933,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|26712933], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR]: repression, [Pubmed|26712933], in [regulon|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|26712933], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    genes
    [gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
    description
    [Pubmed|22383849]

    regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B545 (yulC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1544 NBRP B. subtilis, Japan]
  • BKE31200 ([gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAATGGCAGTATAAATCA, downstream forward: _UP4_AAATGATGAAGAGGTGAAAA
  • BKK31200 ([gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAATGGCAGTATAAATCA, downstream forward: _UP4_AAATGATGAAGAGGTGAAAA
  • References

  • 26712933,16674975,24391637,22383849