SubtiBank SubtiBank
csoR
The papers of the month are back! Check them out! Link here

csoR

transcription repressor of copZ-copA
locus
BSU33520
pI
7.30
mw
11.34 kDa
protein length
101 aa Sequence Blast
gene length
303 bp Sequence Blast
function
control of copper homeostasis
product
transcription repressor
essential
no
synonyms
yvgZ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,443,896 → 3,444,201

    The protein

    Effectors of protein activity

  • Cu(I) ions cause release of CsoR from its operator sites
  • Biological materials

    Mutant

  • MGNA-B604 (yvgZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1603 NBRP B. subtilis, Japan]
  • BKE33520 (Δ[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGTACACCTCTGTTTA, downstream forward: _UP4_TAAAGCGTTTTTTATTGTAA
  • BKK33520 (Δ[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGTACACCTCTGTTTA, downstream forward: _UP4_TAAAGCGTTTTTTATTGTAA
  • Labs working on this gene/protein

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • References

    Reviews

  • 22918892,25209494
  • Original publications

  • 18048925,19168619,20233928,19168619,19249860