SubtiBank SubtiBank
rpsT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpsT

ribosomal protein
locus
BSU_25550
pI
11.24
mw
9.36 kDa
protein length
gene length
267 bp Sequence Blast
function
translation
product
ribosomal protein S20 (BS20)
essential
no
synonyms
yqeO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    2,635,815 2,636,081

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bS20 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|697B714A2AC7B418A7F699B4547BE896B3A8A28B|rpsT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25550 ([gene|697B714A2AC7B418A7F699B4547BE896B3A8A28B|rpsT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCACCTCCTAAG, downstream forward: _UP4_TCTGCATAATATAAAAACGA
  • BKK25550 ([gene|697B714A2AC7B418A7F699B4547BE896B3A8A28B|rpsT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCACCTCCTAAG, downstream forward: _UP4_TCTGCATAATATAAAAACGA
  • References

  • 19653700,23002217,25903689