SubtiBank SubtiBank
rpsT
The papers of the month are back! Check them out! Link here

rpsT

ribosomal protein
locus
BSU25550
pI
11.24
mw
9.36 kDa
protein length
gene length
264 bp Sequence Blast
function
translation
product
ribosomal protein S20 (BS20)
essential
no
synonyms
yqeO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    2,635,815 → 2,636,081

    The protein

    Protein family

  • [SW|ribosomal protein] S20P family (according to Swiss-Prot)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|697B714A2AC7B418A7F699B4547BE896B3A8A28B|rpsT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25550 (Δ[gene|697B714A2AC7B418A7F699B4547BE896B3A8A28B|rpsT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCACCTCCTAAG, downstream forward: _UP4_TCTGCATAATATAAAAACGA
  • BKK25550 (Δ[gene|697B714A2AC7B418A7F699B4547BE896B3A8A28B|rpsT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCACCTCCTAAG, downstream forward: _UP4_TCTGCATAATATAAAAACGA
  • References

  • 19653700,23002217,25903689