SubtiBank SubtiBank
ytzH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytzH

unknown
locus
BSU_29910
pI
4.65
mw
10.55 kDa
protein length
gene length
279 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,060,395 3,060,673

    Expression and Regulation

    Operons

    genes
    [gene|69AC92F8AA038CC93DCA8DB173A9F9BD9C517AEF|ytzH]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE29910 ([gene|69AC92F8AA038CC93DCA8DB173A9F9BD9C517AEF|ytzH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGGTACACATCCCTT, downstream forward: _UP4_GAGCAAATGGATTCGTATTC
  • BKK29910 ([gene|69AC92F8AA038CC93DCA8DB173A9F9BD9C517AEF|ytzH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGGTACACATCCCTT, downstream forward: _UP4_GAGCAAATGGATTCGTATTC