SubtiBank SubtiBank
yngB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yngB

similar to UTP-glucose-1-phosphate uridylyltransferase
locus
BSU_18180
pI
5.20
mw
32.99 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • Gene

    Coordinates
    1,946,702 1,947,595

    The protein

    Catalyzed reaction/ biological activity

  • α-D-glucose 1-phosphate + H+ + UTP --> diphosphate + UDP-α-D-glucose (according to UniProt)
  • Protein family

  • UDPGP type 2 family (with [protein|D368988F85D8436DD424B0B4A1591BDF092A8EA7|GtaB] and [protein|FC455B727F66632D94D93E103B30748944ED04A0|YtdA], according to UniProt)
  • Paralogous protein(s)

  • [protein|D368988F85D8436DD424B0B4A1591BDF092A8EA7|GtaB], [protein|FC455B727F66632D94D93E103B30748944ED04A0|YtdA]
  • Structure

  • [PDB|5I1F] (from Burkholderia vietnamiensis, 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CBCBF948979D9D63CBA86A9ED865E43B1F85A0AD|yngA]-[gene|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|yngB]-[gene|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC]
    description
    [Pubmed|20512483]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B396 (yngB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1395 NBRP B. subtilis, Japan]
  • BKE18180 ([gene|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|yngB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCACTTTTTTTCTCATTC, downstream forward: _UP4_TAAAAAAATTGTAACCATCT
  • BKK18180 ([gene|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|yngB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCACTTTTTTTCTCATTC, downstream forward: _UP4_TAAAAAAATTGTAACCATCT
  • References

  • 20512483