SubtiBank SubtiBank
senS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

senS

transcriptional regulator of extracellular enzyme genes
locus
BSU_08810
pI
10.55
mw
8.50 kDa
protein length
gene length
219 bp Sequence Blast
function
regulation of extracellular enzyme genes
product
transcriptional regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    959,290 959,508

    The protein

    additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000063 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]
    description
    [Pubmed|2108127]
    view in new tab

    Biological materials

    Mutant

  • BKE08810 ([gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT, downstream forward: _UP4_TGACTACAACGGGTTTTTGC
  • BKK08810 ([gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT, downstream forward: _UP4_TGACTACAACGGGTTTTTGC
  • References

  • 1479343,2108127,16321961