SubtiBank SubtiBank
senS
The papers of the month are back! Check them out! Link here

senS

transcriptional regulator of extracellular enzyme genes
locus
BSU08810
pI
10.55
mw
8.50 kDa
protein length
gene length
216 bp Sequence Blast
function
regulation of extracellular enzyme genes
product
transcriptional regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    959,290 → 959,508

    The protein

    additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000063 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]
    description
    [Pubmed|2108127]
    view in new tab

    Biological materials

    Mutant

  • BKE08810 (Δ[gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT, downstream forward: _UP4_TGACTACAACGGGTTTTTGC
  • BKK08810 (Δ[gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT, downstream forward: _UP4_TGACTACAACGGGTTTTTGC
  • References

  • 1479343,2108127,16321961