SubtiBank SubtiBank
bglA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bglA

6-phospho-beta-glucosidase
locus
BSU_40110
pI
4.65
mw
54.67 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
beta-glucoside utilization
product
6-phospho-beta-glucosidase)
essential
no
ec
3.2.1.86
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.18|Utilization of beta-glucosides]
  • Gene

    Coordinates
    4,121,166 4,122,605

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 1 family] (according to UniProt)
  • Structure

  • [PDB|2XHY] (from E. coli, 66% identity) [pubmed|22393408]
  • Expression and Regulation

    Operons

    genes
    [gene|FF3C9A092A3CAE0EB808F9C615BF5FC433C17E81|yyzE]-[gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE40110 ([gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCATGTTTAATT, downstream forward: _UP4_TAAGAAGCGCTCGAATCGAG
  • BKK40110 ([gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCATGTTTAATT, downstream forward: _UP4_TAAGAAGCGCTCGAATCGAG
  • References

  • 14652714,15139916,10627040,8125345