SubtiBank SubtiBank
ytrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytrA

transcriptional repressor, [SW|GntR family], control of cell envelope stress responses in response to ramoplanin
locus
BSU_30460
pI
8.09
mw
14.55 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
control of cell envelope stress responses
product
transcriptional repressor ([SW|GntR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • Gene

    Coordinates
    3,118,847 3,119,239

    Phenotypes of a mutant

  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|3NEU] (similar protein from ''Listeria innocua'', 41% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]
    description
    [Pubmed|10986249,21856850]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|10986249,21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • expressed early in the stationary phase [Pubmed|10986249]
  • view in new tab

    Biological materials

    Mutant

  • GP2641 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP2647 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A138 (ytrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/138 NBRP B. subtilis, Japan]
  • BKE30460 ([gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT, downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
  • BKK30460 ([gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT, downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
  • References

  • 10986249,12399512,23504016,21856850,28189581