SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional repressor, GntR family, control of cell envelope stress responses in response to ramoplanin
14.55 kDa
protein length
130 aa Sequence Blast
gene length
390 bp Sequence Blast
control of cell envelope stress responses
transcriptional repressor (GntR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • Gene

    3,118,847 → 3,119,239

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|3NEU] (similar protein from ''Listeria innocua'', 41% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|10986249,21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • expressed early in the stationary phase [Pubmed|10986249]
  • view in new tab

    Biological materials


  • MGNA-A138 (ytrA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30460 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT, downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
  • BKK30460 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT, downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
  • References

  • 10986249,12399512,23504016,21856850