SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


proline transporter
53.12 kDa
protein length
492 aa Sequence Blast
gene length
1479 bp Sequence Blast
compatible solute transport
proline transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Solute:sodium symporter family]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Sodium-solute symporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Uptake of compatible solutes]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    726,840 728,318

    Phenotypes of a mutant

  • strong growth disadvantage in high-salinity minimal media lacking proline [Pubmed|22685134]
  • The protein

    Protein family

  • [SW|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|PutP]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|9701821], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by glucose ([protein|search|CcpA]) [Pubmed|22900538]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • BKE06660 ([gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA, downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
  • BKK06660 ([gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA, downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References


  • 27935846
  • Original publications

  • 12884008,9701821,11902719,11902719,22685134,22900538,22383849,24142252,22139509,26728461