SubtiBank SubtiBank
lytC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytC

N-acetylmuramoyl-L-alanine amidase, required for flagellar function
locus
BSU_35620
pI
10.11
mw
52.46 kDa
protein length
496 aa Sequence Blast
gene length
1491 bp Sequence Blast
function
major autolysin, cell separation, wall turnover
product
N-acetylmuramoyl-L-alanine amidase
essential
no
ec
3.5.1.28
synonyms
cwlB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.4|Motility and chemotaxis/ other]
  • Gene

    Coordinates
    3,659,119 3,660,609

    Phenotypes of a mutant

  • impaired in motility, the phenotype is suppressed by mutations in ''[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]'' or ''[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]'' [Pubmed|19542270]
  • The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 3 family] (according to UniProt)
  • [SW|Domains]

  • contains an amidase_3 domain (like [protein|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|CwlC], [protein|B09FB626274B81F00A4FB42D188E089095343182|CwlD], [protein|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|YqiI], [protein|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|YrvJ])
  • [SW|MurNAc-LAA domain] (aa 322-490) (according to UniProt)
  • Structure

  • [PDB|5J72] (from Clostridium difficile, 32% identity) [pubmed|28132783]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]
    description
    [Pubmed|1357079]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1357079], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|1357079], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: repression, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]: repression, (in complex with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]) [Pubmed|20351052], in [regulon|920F91E748EE079FF864011D9052B073567C41E4|SlrR regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1A789 ( ''lytC''::''kan''), [Pubmed|1588906], available the [http://bgsc.org/getdetail.php?bgscid=1A789 Bacillus Genetic Stock Center]
  • BKE35620 ([gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATTTCCTCCTTAAA, downstream forward: _UP4_TAATCGAAAGAGACAAATCT
  • BKK35620 ([gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATTTCCTCCTTAAA, downstream forward: _UP4_TAATCGAAAGAGACAAATCT
  • References

  • 19542270,10945275,14594841,1357079,16306698,20351052,9158733,27118079,28132783