SubtiBank SubtiBank
cinA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cinA

plays a nucleoid-associated general role in cells entering stationary phase
locus
BSU_16930
pI
5.40
mw
45.37 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ymfO,yzlB

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,763,222 1,764,472

    The protein

    Protein family

  • cinA family (single member, according to UniProt)
  • Structure

  • [PDB|4CT8] (from Aquifex aeolicus, 33% identity) [pubmed|25313401]
  • [SW|Localization]

  • associated with the nucleoid [Pubmed|20480359]
  • Biological materials

    Mutant

  • MGNA-B122 (cinA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1121 NBRP B. subtilis, Japan]
  • BKE16930 ([gene|6A3925E2D030090143828352F86DB3F1FB18F5F2|cinA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGACGAAGTCCTTCT, downstream forward: _UP4_TAATATTTTCAGCACATTAT
  • BKK16930 ([gene|6A3925E2D030090143828352F86DB3F1FB18F5F2|cinA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGACGAAGTCCTTCT, downstream forward: _UP4_TAATATTTTCAGCACATTAT
  • References

  • 20480359,25313401