The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cinA

plays a nucleoid-associated general role in cells entering stationary phase

locus: BSU_16930

pI: 5.40

mw: 45.37 kDa

protein length: 416 aa

gene length: 1251 bp

function: unknown

product: unknown

essential: no

synonyms: ymfO,yzlB

Genomic Context

categories

• [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]

Gene

Coordinates: 1,763,222 1,764,472

The protein

Protein family

• cinA family (single member, according to UniProt)

Structure

• [PDB|4CT8] (from Aquifex aeolicus, 33% identity) [pubmed|25313401]

[SW|Localization]

• associated with the nucleoid [Pubmed|20480359]

Biological materials

Mutant

• MGNA-B122 (cinA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1121 NBRP B. subtilis, Japan]
• BKE16930 ([gene|6A3925E2D030090143828352F86DB3F1FB18F5F2|cinA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGACGAAGTCCTTCT, downstream forward: _UP4_TAATATTTTCAGCACATTAT
• BKK16930 ([gene|6A3925E2D030090143828352F86DB3F1FB18F5F2|cinA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGACGAAGTCCTTCT, downstream forward: _UP4_TAATATTTTCAGCACATTAT

References

• 20480359,25313401