SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcriptional regulator ([SW|MocR/ GabR family])
54.11 kDa
protein length
484 aa Sequence Blast
gene length
1455 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    1,166,737 1,168,191

    The protein

    Protein family

  • [SW|MocR/ GabR family] [Pubmed|22020104]
  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B1A95EAE40AFA40BF12EE9B41287921417A39562|YdfD]
  • [SW|Domains]

  • N-terminal DNA-binding helix-turn-helix motif; C-terminal domain is homologous to PLP-binding large domain of aminotransferases.
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1WST] (aminotransferase from Thermococcus profundus, 29% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B211 (yisW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10880 ([gene|6A3F08CD939CCDEC1F784D658B815A6D0E1AAC3D|yisV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCCCCCTTTTTTACAC, downstream forward: _UP4_CGCCTGATGATGTCCTAGGC
  • BKK10880 ([gene|6A3F08CD939CCDEC1F784D658B815A6D0E1AAC3D|yisV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCCCCCTTTTTTACAC, downstream forward: _UP4_CGCCTGATGATGTCCTAGGC
  • References

  • 11756427,22020104