SubtiBank SubtiBank
pycA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pycA

pyruvate carboxylase
locus
BSU14860
pI
5.41
mw
127.72 kDa
protein length
1148 aa Sequence Blast
gene length
3444 bp Sequence Blast
function
replenishment of the oxaloacetate pool
product
pyruvate carboxylase
essential
no
synonyms
ylaP

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,554,185 → 1,557,631

    The protein

    [SW|Cofactors]

  • biotin [Pubmed|24816803]
  • Structure

  • [PDB|3BG5] (''S. aureus'') [pubmed|18297087]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
  • Additional information

  • PycA binds to StrepTactin, and may be co-purified when purifying Strep-tagged proteins by [SW|SPINE].
  • PycA is subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW]-[gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|YofA]: activation, [Pubmed|17526699], in [regulon|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|YofA regulon]
  • [regulon|stringent response|stringent response]: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    genes
    [gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]
    description
    [Pubmed|20081037]

    regulation

  • subject to positive stringent control upon lysine starvation [Pubmed|20081037]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A544 (ylaP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/544 NBRP B. subtilis, Japan]
  • GP793 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE14860 (Δ[gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC, downstream forward: _UP4_TAAAAAACAAAGAGTGTATA
  • BKK14860 (Δ[gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC, downstream forward: _UP4_TAAAAAACAAAGAGTGTATA
  • Expression vectors

  • pGP1289 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Stülke] lab
  • References

    Reviews

  • 18613815,12769720,10229653,9597748,7780827,28271481
  • Original publications

  • 18763711,20081037,24825009,25755103,24816803,18297087