SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyruvate carboxylase
127.72 kDa
protein length
1148 aa Sequence Blast
gene length
3447 bp Sequence Blast
replenishment of the oxaloacetate pool
pyruvate carboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,554,185 1,557,631

    The protein

    Catalyzed reaction/ biological activity

  • ATP + hydrogencarbonate + pyruvate --> ADP + H+ + oxaloacetate + phosphate (according to UniProt)
  • [SW|Cofactors]

  • biotin [Pubmed|24816803]
  • Structure

  • [PDB|3BG5] (''S. aureus'') [pubmed|18297087]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
  • Additional information

  • PycA binds to StrepTactin, and may be co-purified when purifying Strep-tagged proteins by [SW|SPINE].
  • PycA is subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|YofA]: activation, [Pubmed|17526699], in [regulon|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|YofA regulon]
  • [regulon|stringent response|stringent response]: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab



  • subject to positive stringent control upon lysine starvation [Pubmed|20081037]
  • view in new tab

    Biological materials


  • MGNA-A544 (ylaP::erm), available at the [ NBRP B. subtilis, Japan]
  • GP793 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE14860 ([gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC, downstream forward: _UP4_TAAAAAACAAAGAGTGTATA
  • BKK14860 ([gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC, downstream forward: _UP4_TAAAAAACAAAGAGTGTATA
  • Expression vectors

  • pGP1289 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • References


  • 18613815,12769720,10229653,9597748,7780827,28271481
  • Original publications

  • 18763711,20081037,24825009,25755103,24816803,18297087