SubtiBank SubtiBank
ywqB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywqB

unknown
locus
BSU_36270
pI
7.62
mw
63.06 kDa
protein length
536 aa Sequence Blast
gene length
1611 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,733,852 3,735,462

    Expression and Regulation

    Operons

    genes
    [gene|6AFE06E2F5A5382FBC656E6D532E1D8BFECC4DC2|ywqB]-[gene|265490FA83D6D3F178C26C9240E3CB224513BF42|ywqA]
    description
    [Pubmed|22383849]

    additional information

  • An [ncRNA|search|antisense RNA] is predicted for [gene|265490FA83D6D3F178C26C9240E3CB224513BF42|ywqA] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A579 (ywqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/579 NBRP B. subtilis, Japan]
  • BKE36270 ([gene|6AFE06E2F5A5382FBC656E6D532E1D8BFECC4DC2|ywqB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTATCGCTCCTAACC, downstream forward: _UP4_TTGATGGCGAGTCTTAAAGA
  • BKK36270 ([gene|6AFE06E2F5A5382FBC656E6D532E1D8BFECC4DC2|ywqB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTATCGCTCCTAACC, downstream forward: _UP4_TTGATGGCGAGTCTTAAAGA