SubtiBank SubtiBank
capE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

capE

stimulates poly-gamma-glutamate production in the presence of zinc, also involved in extra-chromosomal DNA maintenance
locus
BSU_35870
pI
6.49
mw
6.39 kDa
protein length
gene length
168 bp Sequence Blast
function
capsule synthesis
product
unknown
essential
no
synonyms
ywtC,pgsE,edmS

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,697,639 3,697,806

    The protein

    Catalyzed reaction/ biological activity

  • stimulates poly-gamma-glutamate production in the presence of zinc [Pubmed|20812257]
  • also involved in extra-chromosomal DNA maintenance [Pubmed|23583563,21357437]
  • [SW|Domains]

  • N-terminal membrane-anchoring domain and a C-terminal assembly accelerator-like structure [Pubmed|23583563]
  • [SW|Localization]

  • cell membrane [Pubmed|23583563]
  • Expression and Regulation

    Operons

    genes
    [gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]
    description
    [Pubmed|11751809]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19420703], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|19734658], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • expression of the operon is increased in '[protein|search|motA]' or '[protein|search|motB]' mutants due to increased [protein|search|DegU] phosphorylation [PubMed|24296669]
  • view in new tab

    Biological materials

    Mutant

  • BKE35870 ([gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATTTCATCTTTATCACTC, downstream forward: _UP4_TAATTCAAAAAAGAGAGTGT
  • BKK35870 ([gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATTTCATCTTTATCACTC, downstream forward: _UP4_TAATTCAAAAAAGAGAGTGT
  • References

    Reviews

  • 16689787,29215550
  • Original publications

  • 19420703,16233197,16267300,20564357,20564574,21357437,23583563,20812257,21965392,25843804,30295732