SubtiBank SubtiBank
cotR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotR

outer spore coat protein, lipolytic enzyme
locus
BSU_34530
pI
10.20
mw
35.20 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
function
hydrolysis of lysophospholipids
product
outer spore coat lipolytic enzyme
essential
no
synonyms
yvdO

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    3,544,642 3,545,604

    The protein

    Catalyzed reaction/ biological activity

  • release of myristic acid from 1-myristoly-2-lyso-sn-glycero-3-phosphocholine [Pubmed|20378985]
  • [SW|Domains]

  • PNPLA domain (aa 7-182) (according to UniProt)
  • [SW|Localization]

  • outer spore coat [pubmed|28870294]
  • Expression and Regulation

    Operons

    genes
    [gene|6B9B62D9687331CDC2677C78A624FA609C8F8CFC|cotR]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B621 (yvdO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1620 NBRP B. subtilis, Japan]
  • BKE34530 ([gene|6B9B62D9687331CDC2677C78A624FA609C8F8CFC|cotR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCTGATGTCTCCTTTC, downstream forward: _UP4_TAATTATTTATTTTAAATCA
  • BKK34530 ([gene|6B9B62D9687331CDC2677C78A624FA609C8F8CFC|cotR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCTGATGTCTCCTTTC, downstream forward: _UP4_TAATTATTTATTTTAAATCA
  • References

  • 11737650,15699190,20378985,28870294