SubtiBank SubtiBank
ylaA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylaA

unknown
locus
BSU_14710
pI
6.75
mw
74.74 kDa
protein length
646 aa Sequence Blast
gene length
1941 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,541,886 1,543,826

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]-[gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]-[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
    description
    [Pubmed|16501307]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16501307], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]: sigma factor, [Pubmed|16501307], in [regulon|544344B61A804F367BB726976E0C87B61998490A|YlaC regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16501307], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A534 (ylaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/534 NBRP B. subtilis, Japan]
  • BKE14710 ([gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTTTACTTCTTATTA, downstream forward: _UP4_GAAACACAAGAGGTGAAAAG
  • BKK14710 ([gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTTTACTTCTTATTA, downstream forward: _UP4_GAAACACAAGAGGTGAAAAG
  • References

  • 16501307