SubtiBank SubtiBank
acpK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

acpK

acyl carrier protein
locus
BSU_17130
pI
4.11
mw
9.11 kDa
protein length
gene length
249 bp Sequence Blast
function
polyketide biosynthesis
product
acyl carrier protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,788,469 1,788,717

    The protein

    [SW|Domains]

  • [SW|Carrier domain] (aa 4-79) (according to UniProt)
  • Structure

  • [PDB|5KP7] (53% identity) [pubmed|27573844]
  • Expression and Regulation

    Operons

    genes
    [gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    genes
    [gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17130 ([gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCGCTCTCTCCTTC, downstream forward: _UP4_ATCGGTGAATTAGCTGAGGT
  • BKK17130 ([gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCGCTCTCTCCTTC, downstream forward: _UP4_ATCGGTGAATTAGCTGAGGT
  • References

  • 11489886,22383849,24187085,27573844