SubtiBank SubtiBank
phoH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phoH

phosphate starvation-induced protein
locus
BSU_25340
pI
6.12
mw
35.42 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
unkown
product
unknown
essential
no
synonyms
yqfE

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,614,496 2,615,455

    The protein

    Protein family

  • phoH family (with [protein|5913ABC121A03644897BD365D7E507661CD3AF39|YlaK], according to UniProt)
  • Paralogous protein(s)

  • [protein|5913ABC121A03644897BD365D7E507661CD3AF39|YlaK]:
  • Structure

  • [PDB|3B85] (aa 115-315, the protein from ''Corynebacterium glutamicum'', 65% identity, 90% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C422 (yqfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2420 NBRP B. subtilis, Japan]
  • BKE25340 ([gene|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATCGCAAGTAAATGTT, downstream forward: _UP4_TAATGCTGAATGACCCGATC
  • BKK25340 ([gene|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATCGCAAGTAAATGTT, downstream forward: _UP4_TAATGCTGAATGACCCGATC
  • References

  • 12762842