SubtiBank SubtiBank
yjkA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjkA

similar to amino acid ABC transporter (membrane protein)
locus
BSU_12240
pI
10.34
mw
27.27 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
unknown
product
ABC transporter (membrane protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,294,996 1,295,748

    The protein

    Protein family

  • UPF0014 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|E93AE502A575BFB185A5D782B2F40AD53B27093E|yjkB]-[gene|6C432E77C5A6F9955DDF4F7BE3FFD55C30BB812A|yjkA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A363 (yjkA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/363 NBRP B. subtilis, Japan]
  • BKE12240 ([gene|6C432E77C5A6F9955DDF4F7BE3FFD55C30BB812A|yjkA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAGAGAGAGAAAGGTAAT, downstream forward: _UP4_TGACAGACAAAAGCCGCTTT
  • BKK12240 ([gene|6C432E77C5A6F9955DDF4F7BE3FFD55C30BB812A|yjkA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAGAGAGAGAAAGGTAAT, downstream forward: _UP4_TGACAGACAAAAGCCGCTTT
  • References

  • 10092453