SubtiBank SubtiBank
yybA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yybA

similar to transcriptional regulator ([SW|MarR family])
locus
BSU_40710
pI
9.81
mw
17.44 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|MarR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    4,183,445 4,183,897

    The protein

    Structure

  • [PDB|1LJ9] (SlyA from Enterococcus faecalis, 69% identity) [pubmed|12649270]
  • Biological materials

    Mutant

  • MGNA-B853 (yybA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1852 NBRP B. subtilis, Japan]
  • BKE40710 ([gene|6C48D8865633A04AA6266A0FACDC25840282A5F2|yybA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTAAAACCCCTCACG, downstream forward: _UP4_TAATGGACAACGTTAACAAG
  • BKK40710 ([gene|6C48D8865633A04AA6266A0FACDC25840282A5F2|yybA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTAAAACCCCTCACG, downstream forward: _UP4_TAATGGACAACGTTAACAAG
  • References

    Research papers

  • 12649270