SubtiBank SubtiBank
ypqA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ypqA

unknown
locus
BSU_22240
pI
5.04
mw
16.18 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,337,577 2,337,996

    The protein

    Protein family

  • [SW|small heat shock protein (Hsp20) family] (according to UniProt)
  • [SW|Domains]

  • sHSP domain (aa 44-139) (according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6C4B332D3532FD1B5DBF94CEBE55075AAEADB8AB|ypqA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A471 (ypqA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/471 NBRP B. subtilis, Japan]
  • BKE22240 ([gene|6C4B332D3532FD1B5DBF94CEBE55075AAEADB8AB|ypqA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCGCCACCGCCTTTT, downstream forward: _UP4_TGAACGATTCATTCATGCTT
  • BKK22240 ([gene|6C4B332D3532FD1B5DBF94CEBE55075AAEADB8AB|ypqA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCGCCACCGCCTTTT, downstream forward: _UP4_TGAACGATTCATTCATGCTT
  • References

  • 15699190,15383836