SubtiBank SubtiBank
ytvA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytvA

blue light sensor, positive regulation of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity under conditions of blue light
locus
BSU_30340
pI
4.69
mw
29.04 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
product
blue light receptor, flavoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    3,106,210 3,106,995

    The protein

    Catalyzed reaction/ biological activity

  • mediates light-dependent stimulation of [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] kinase activity [Pubmed|23416074]
  • Paralogous protein(s)

  • [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|RsbRC], [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]
  • [SW|Domains]

  • [SW|PAS domain] (aa 12-87) (according to UniProt)
  • [SW|PAC domain] (aa 88-138) (according to UniProt)
  • [SW|STAS domain] (aa 147-258) (according to UniProt)
  • [SW|Cofactors]

  • FMN
  • Effectors of protein activity

  • [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]-dependent light activation of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] stress response is positively and negatively regulated by [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] and [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], respectively [Pubmed|22287516]
  • Structure

  • [PDB|2PR5] (dark), [PDB|2PR6] (light), [PDB|2MWG]
  • Expression and Regulation

    Operons

    genes
    [gene|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16923906], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A136 (ytvA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/136 NBRP B. subtilis, Japan]
  • 1A965 ( ''ytvA''::''erm''), [Pubmed|11157946], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A965&Search=1A965 BGSC]
  • BKE30340 ([gene|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAATCCCCCTTAGGC, downstream forward: _UP4_TAAAAAGATCCCGCTCACCC
  • BKK30340 ([gene|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAATCCCCCTTAGGC, downstream forward: _UP4_TAAAAAGATCCCGCTCACCC
  • Expression vectors

  • pGP2685, expression of His-[protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA] in ''E. coli'' (based on [SW|pGP570]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

    Reviews

  • 18400553,21822294,26189730,28271471
  • Original publications

  • 27203230,19581299,16923906,17575448,17764689,17443319,17200735,16923909,16797012,16022561,15339223,11964249,11157946,19891470,20062844,19783626,20800068,22247770,23047813,23416074,23456923,23817467,21259411,21388385,21410163,21851109,22287516,23861663,23828427,23900620,23940057,24171435,24278408,25211155,26402155,31707658,32579655