SubtiBank SubtiBank
yobQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobQ

similar to transcription factor ([SW|AraC family])
locus
BSU_19050
pI
8.48
mw
28.11 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,079,611 2,080,336

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [SW|cupin 2 domain] (aa 22 ... 78)
  • [SW|DNA binding HTH domain, AraC-type] (aa 137 ... 235)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|EDD0C5732E487A7F94684289F59B9130773316C1|yobT]-[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]-[gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A313 (yobQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/313 NBRP B. subtilis, Japan]
  • BKE19050 ([gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGCAAACCCCTTCCTT, downstream forward: _UP4_TGATGGCTCTTTAGTTAAAA
  • BKK19050 ([gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGCAAACCCCTTCCTT, downstream forward: _UP4_TGATGGCTCTTTAGTTAAAA
  • References

  • 23504016