SubtiBank SubtiBank
cgeC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cgeC

maturation of the outermost layer of the spore
locus
BSU_19770
pI
4.78
mw
11.24 kDa
protein length
101 aa Sequence Blast
gene length
306 bp Sequence Blast
function
maturation of the outermost layer of the spore
product
unknown
essential
no
synonyms
cgeBA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,148,166 2,148,471

    Expression and Regulation

    Operons

    genes
    [gene|6C7778EFFADDF522E2DBC32219D83E7CBCF2BED0|cgeC]-[gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]-[gene|11966AE70567D707D546C4A2F12B2DEAE95A1883|cgeE]
    description
    [Pubmed|7592393]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7592393,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7592393], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|7592393]
  • view in new tab

    Biological materials

    Mutant

  • BKE19770 ([gene|6C7778EFFADDF522E2DBC32219D83E7CBCF2BED0|cgeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCATCCCTCTCCCTTA, downstream forward: _UP4_TAAATGATGACAGAGGCTCT
  • BKK19770 ([gene|6C7778EFFADDF522E2DBC32219D83E7CBCF2BED0|cgeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCATCCCTCTCCCTTA, downstream forward: _UP4_TAAATGATGACAGAGGCTCT
  • References

  • 7592393,15699190