SubtiBank SubtiBank
spoIISB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIISB

disruption blocks sporulation after septum formation
locus
BSU_12820
pI
10.79
mw
6.52 kDa
protein length
gene length
171 bp Sequence Blast
function
sporulation
product
anti-toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • Gene

    Coordinates
    1,348,442 1,348,612

    Phenotypes of a mutant

  • sporulation efficiency is reduced by four orders of magnitude [Pubmed|11371520]
  • The protein

    Protein family

  • SpoIISB antitoxin family (single member, according to UniProt)
  • Structure

  • [PDB|3O6Q] (cytoplasmic fragment of [protein|CD14C88E9976964A0D25BAA22C395A5A6951654D|SpoIISA] (CSpoIISA) in complex with [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|SpoIISB]) [Pubmed|21147767]
  • Expression and Regulation

    Operons

    genes
    [gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]-[gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]
    description
    [Pubmed|11371520]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1S124 ( ''spoIISB''::''tet''), [Pubmed|11371520], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S124&Search=1S124 BGSC]
  • BKE12820 ([gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTTTTGAAACGCACGTT, downstream forward: _UP4_TGATCACACTAAAAGGACAA
  • BKK12820 ([gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTTTTGAAACGCACGTT, downstream forward: _UP4_TGATCACACTAAAAGGACAA
  • References

  • 18096016,11371520,26300872,21147767,27294956