SubtiBank SubtiBank
ctaO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ctaO

heme O synthase (minor enzyme)
locus
BSU_12080
pI
10.12
mw
36.73 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
heme biosynthesis
product
heme O synthase (minor enzyme)
essential
no
synonyms
yjdK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,279,514 1,280,503

    The protein

    Catalyzed reaction/ biological activity

  • (2E,6E)-farnesyl diphosphate + H2O + heme b --> diphosphate + Fe(II)-heme o (according to UniProt)
  • Protein family

  • UbiA prenyltransferase family (with [protein|83F5D5FCCAFADB7231ACD9BE7941820240954C70|CtaB], according to UniProt)
  • Paralogous protein(s)

  • [protein|83F5D5FCCAFADB7231ACD9BE7941820240954C70|CtaB]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6CE139563BBD7C1C97AEC3AA3F88146C4EEA79E4|ctaO]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A273 (yjdK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/273 NBRP B. subtilis, Japan]
  • BKE12080 ([gene|6CE139563BBD7C1C97AEC3AA3F88146C4EEA79E4|ctaO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTTGTTATCGTAAC, downstream forward: _UP4_TGATGCAAAAAGAGCCACAC
  • BKK12080 ([gene|6CE139563BBD7C1C97AEC3AA3F88146C4EEA79E4|ctaO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTTGTTATCGTAAC, downstream forward: _UP4_TGATGCAAAAAGAGCCACAC
  • References

  • 10675592,20817675,21815947