SubtiBank SubtiBank
ydeS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeS

similar to transcriptional regulator ([SW|TetR family])
locus
BSU_05320
pI
7.18
mw
22.00 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    578,337 578,933

    The protein

    Protein family

  • [SW|TetR family]
  • Structure

  • [PDB|2FQ4] (from B. cereus, 76% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|6CF44499017A78B8C43D68259F52056BCCB3EB8A|ydeS]-[gene|B836B265FCC3FBD0BA5DCAC534A72E902C9D45EE|ydzO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C140 (ydeS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2138 NBRP B. subtilis, Japan]
  • BKE05320 ([gene|6CF44499017A78B8C43D68259F52056BCCB3EB8A|ydeS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAAATCATTCCTTCCC, downstream forward: _UP4_TAGCTGATAAGAACTGCAAA
  • BKK05320 ([gene|6CF44499017A78B8C43D68259F52056BCCB3EB8A|ydeS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAAATCATTCCTTCCC, downstream forward: _UP4_TAGCTGATAAGAACTGCAAA
  • References

    Reviews

  • 24006471