SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional regulator ([SW|GntR family])
27.36 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
regulator of the [gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR] operon
transcriptional regulator ([SW|GntR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,597,289 3,598,020

    The protein

    Catalyzed reaction/ biological activity

  • transcription repression of ''[gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]'' and of the putative ''[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]'' operon in the absence of N-acetylglycosamine [Pubmed|24673833,20047956,21602348], weak repression of ''[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]'' [Pubmed|16207374]
  • Protein family

  • [SW|GntR family] of transcription factors
  • Kinetic information

  • K(D) for N-acetylglucosamine-6-phosphate: 1 mM [Pubmed|20047956]
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 9-77) (according to UniProt)
  • Effectors of protein activity

  • N-acetylglucosamine-6-phosphate and glucosamine-6-phosphate act as the molecular inducers [Pubmed|25564531,21602348,20047956]
  • Structure

  • [PDB|2WV0] [Pubmed|20047956]
  • [PDB|4U0V] (complex with glucosamine-6-phosphate) [Pubmed|25564531]
  • [PDB|4U0W] (complex with N-acetylglucosamine-6-phosphate) [Pubmed|25564531]
  • [PDB|4WWC] (complex with palindromic operator DNA) [Pubmed|25564531]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR]: repression, [Pubmed|24673833,21602348], in [regulon|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|24673833,21602348,14343123]
  • view in new tab

    Biological materials


  • MGNA-A335 (yvoA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35030 ([gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCAGCATGTTCCTT, downstream forward: _UP4_TCATAAAAAAAGCCTCCAAC
  • BKK35030 ([gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCAGCATGTTCCTT, downstream forward: _UP4_TCATAAAAAAAGCCTCCAAC
  • References


  • 26159076
  • Original publications

  • 19342794,20047956,16207374,21602348,23667565,24673833,25564531,30254611