SubtiBank SubtiBank
yojK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yojK

similar to macrolide glycosyltransferase
locus
BSU_19420
pI
4.92
mw
45.44 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    Coordinates
    2,117,051 2,118,268

    The protein

    Protein family

  • UDP-glycosyltransferase family (with [protein|02927D2CC9F44B99DB307DDFED2DD52DE2196120|YjiC] and [protein|BD82663B1BF2763D2D2DE710C2896E4155419324|YdhE], according to UniProt)
  • Structure

  • [PDB|4M83] (from Streptomyces antibioticus, 28% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B425 (yojK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1424 NBRP B. subtilis, Japan]
  • BKE19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • BKK19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • References

  • 27130432,22383849,31786106