SubtiBank SubtiBank
yojK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yojK

similar to macrolide glycosyltransferase
locus
BSU_19420
pI
4.92
mw
45.44 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    Coordinates
    2,117,051 2,118,268

    The protein

    Protein family

  • UDP-glycosyltransferase family (with [protein|02927D2CC9F44B99DB307DDFED2DD52DE2196120|YjiC] and [protein|BD82663B1BF2763D2D2DE710C2896E4155419324|YdhE], according to UniProt)
  • Structure

  • [PDB|4M83] (from Streptomyces antibioticus, 28% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B425 (yojK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1424 NBRP B. subtilis, Japan]
  • BKE19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • BKK19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • References

  • 27130432,22383849,31786106