SubtiBank SubtiBank
yojK [2018-11-07 17:02:06]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yojK [2018-11-07 17:02:06]

similar to macrolide glycosyltransferase
locus
BSU19420
pI
4.92
mw
45.44 kDa
protein length
405 aa Sequence Blast
gene length
1215 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    Coordinates
    2,117,051 → 2,118,268

    Expression and Regulation

    Operons

    genes
    [gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B425 (yojK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1424 NBRP B. subtilis, Japan]
  • BKE19420 (Δ[gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • BKK19420 (Δ[gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • References

  • 27130432,22383849