SubtiBank SubtiBank
yojK [2019-06-21 12:07:42]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yojK [2019-06-21 12:07:42]

similar to macrolide glycosyltransferase
45.44 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    2,117,051 2,118,268

    The protein


  • [PDB|4M83] (from Streptomyces antibioticus, 28% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B425 (yojK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • BKK19420 ([gene|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGCAGCACCCTTCCT, downstream forward: _UP4_TAGTGTAAAAGCCTGTTCTT
  • References

  • 27130432,22383849