SubtiBank SubtiBank
ysmA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ysmA

similar to thioesterase
locus
BSU_28420
pI
5.54
mw
16.93 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,905,067 2,905,510

    The protein

    Structure

  • [PDB|2OIW] (from B. stearothermophilus, 28% identity)
  • Biological materials

    Mutant

  • MGNA-B010 (ysmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1009 NBRP B. subtilis, Japan]
  • BKE28420 ([gene|6E8B67517A81B58707C3841B33057BDA9C4FA1AB|ysmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTCATCTCCTTA, downstream forward: _UP4_TAAACTAATTATCTTGTAAA
  • BKK28420 ([gene|6E8B67517A81B58707C3841B33057BDA9C4FA1AB|ysmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTCATCTCCTTA, downstream forward: _UP4_TAAACTAATTATCTTGTAAA