SubtiBank SubtiBank
coxA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

coxA

spore cortex protein
locus
BSU_27830
pI
9.22
mw
19.39 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
function
resistance of the spore
product
spore cortex protein
essential
no
synonyms
yrbB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,843,931 2,844,527

    Expression and Regulation

    Operons

    genes
    [gene|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA]-[gene|6EAB09018D9AF9C488E713C232CD77B63415DCE3|coxA]
    description
    [Pubmed|10438771]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|10438771], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|10438771]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A010 (yrbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/10 NBRP B. subtilis, Japan]
  • BKE27830 ([gene|6EAB09018D9AF9C488E713C232CD77B63415DCE3|coxA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGAAAAACCCCCCGTG, downstream forward: _UP4_TAGGAAGGAAGGGCTGCCGG
  • BKK27830 ([gene|6EAB09018D9AF9C488E713C232CD77B63415DCE3|coxA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGAAAAACCCCCCGTG, downstream forward: _UP4_TAGGAAGGAAGGGCTGCCGG
  • References

  • 10438771