SubtiBank SubtiBank
mbl [2019-04-15 20:02:05]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mbl [2019-04-15 20:02:05]

cell shape-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] activity
35.70 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast
[SW|cell shape] determination
[protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB]-like protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,747,254 3,748,255

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • non-viable in the presence of low Mg(2 )
  • readily accumulate ''[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]'' suppressor mutants [Pubmed|19114499]
  • The protein

    Catalyzed reaction/ biological activity

  • forms helical filaments in a heterologous system [Pubmed|21091501]
  • required for [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] activity [Pubmed|23869552]
  • Protein family

  • ftsA/mreB family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB], [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH]
  • Structure

  • [PDB|1JCF] ([protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] from ''Thermotoga maritima'', 52% identity) [Pubmed|11544518]
  • [SW|Localization]

  • during logarithmic growth, [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl] forms discrete patches that move processively along peripheral tracks perpendicular to the cell axis [Pubmed|21636744]
  • forms transverse bands as cells enter the stationary phase [Pubmed|21636744]
  • close to the inner surface of the cytoplasmic membrane [Pubmed|16950129]
  • reports on helical structures formed by Mbl [Pubmed|16950129,20566861] seem to be misinterpretation of data [Pubmed|21636744]
  • Mbl patch speed depends on the growth rate, the faster growth, the higher the patch speed [pubmed|28589952]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, promoter p1, upstream of [protein|487990143C84D245743C0014E648699627204FF0|Usd] [Pubmed|9023218], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p2, upstream of [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|9023218]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mbl]' [PubMed|20525796]
  • view in new tab


    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|9023218], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|9023218]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mbl]' [PubMed|20525796]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • BKE36410 ([gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTATATCCTCCTT, downstream forward: _UP4_TGATTTCACAAACCTCATTC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Boris Görke]'s lab
  • Antibody

  • available in the [SW|Jeff Errington]'s and [SW|Peter Graumann]'s labs
  • labs

  • [SW|Peter Graumann], Freiburg University, Germany [ homepage]
  • References


  • 17064365,20566861,21636744,21636745,22069484,29203279
  • Other original publications

  • 19643765,16832063,11290328,12809607,16101995,12530960,7836311,16950129,9023218,19659933,19114499,21091501,20525796,22048160,22343529,23879732,23869552,26091431,22383849,27215790,28189581,28589952,26883633