SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


part of the flagellar type III export apparatus (flagellar Type III secretion system), part of the CORE complex required for flagellum and nanotube assembly
24.71 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
flagellum and nanotube assembly
part of the type III CORE export apparatus

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,704,863 1,705,528

    Phenotypes of a mutant

  • no secretion of [protein|F03144BF8A187C8931938A21433431B8961E8EE7|FlgM], permanent inhibition of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD] [Pubmed|25313396]
  • deficient in both nanotube production and the associated intercellular molecular trafficking [pubmed|30929979]
  • The protein

    Protein family

  • FliP/MopC/SpaP family (single member, according to UniProt)
  • Structure

  • [PDB|6F2D] (the [protein|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|FliP]-[protein|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|FliQ]-[protein|9856F25F23264AD1402A85AE9E25F10B68CAD739|FliR] complex of Salmonella typhimurium, 53% identity) [pubmed|29967543]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • flagellum basal body (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16350 ([gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTGAACTGAAAATATTTA, downstream forward: _UP4_AGCTTTTAGGGTAGGTGCTA
  • BKK16350 ([gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTGAACTGAAAATATTTA, downstream forward: _UP4_AGCTTTTAGGGTAGGTGCTA
  • References


  • 26490009
  • Original publications

  • 8299954,1597417,17850253,14651647,9657996,8157612,15175317,25313396,24386445,26244495,29967543,30929979