SubtiBank SubtiBank
ytkP

ytkP

similar to cysteine synthase
locus
BSU_29970
pI
4.93
mw
32.91 kDa
protein length
311 aa Sequence Blast
gene length
933 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.5.1.47
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,066,451 → 3,067,386

    The protein

    Catalyzed reaction/ biological activity

  • O(3)-acetyl-L-serine + H2S --> L-cysteine + acetate (according to UniProt)
  • Protein family

  • Cysteine synthase/cystathionine beta-synthase family (with [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|CysK] and [protein|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|MccA], according to UniProt)
  • Paralogous protein(s)

  • [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|CysK], [protein|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|MccA]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2EGU] (from Geobacillus Kaustophilus 57% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|ytkP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B534 (ytkP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1533 NBRP B. subtilis, Japan]
  • BKE29970 (Δ[gene|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|ytkP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCATTCCTTTCTGAA, downstream forward: _UP4_TAAAAAAAGGACTGGCTTCA
  • BKK29970 (Δ[gene|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|ytkP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCATTCCTTTCTGAA, downstream forward: _UP4_TAAAAAAAGGACTGGCTTCA