SubtiBank SubtiBank
ldt
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ldt

L,D-transpeptidase involved in cell wall synthesis
locus
BSU_14040
pI
10.25
mw
17.59 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast
function
cell wall biosynthesis
product
L,D-transpeptidase
essential
no
synonyms
ykuD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,476,518 1,477,012

    The protein

    Protein family

  • YkuD family (with [protein|456AF184261976FAA73359E81443F7035F457D07|YciB] and [protein|293794B65B9EEB7F049138F73893303BABFB9A2A|YqjB], according to UniProt)
  • Paralogous protein(s)

  • [protein|293794B65B9EEB7F049138F73893303BABFB9A2A|YqjB]
  • [SW|Domains]

  • contains a N-terminal N-acetylglucosamine-polymer-binding [SW|LysM domain] [Pubmed|18430080]
  • [SW|LysM domain] (aa 2-45) (according to UniProt)
  • Structure

  • [PDB|1Y7M] [Pubmed|16287140]
  • [PDB|2MTZ] (complex with a peptidoglycan hexamuropeptide) [Pubmed|25429710]
  • [SW|Localization]

  • spore wall (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]
    description
    [Pubmed|11011148]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|11011148], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
  • view in new tab

    genes
    [gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]-[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]-[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A766 (ykuD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/766 NBRP B. subtilis, Japan]
  • BKE14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT, downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
  • BKK14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT, downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
  • References

    Reviews

  • 18430080
  • Original publications

  • 12850135,11011148,17311917,22383849,22278298,22579252,16287140,25429710