SubtiBank SubtiBank
glcR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glcR

transcriptional repressor ([SW|DeoR family]) of the [gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]-[gene|search|phoC] operon
locus
BSU_36300
pI
5.69
mw
28.67 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
function
unknown
product
transcriptional repressor ([SW|DeoR family])
essential
no
synonyms
ywpI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,739,206 3,739,982

    The protein

    Protein family

  • [SW|DeoR family] of transcription factors
  • Additional information

  • Mutant forms of GlcR act as "super-repressors" of'' [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]'' expression [Pubmed|11491085]
  • Expression and Regulation

    Operons

    genes
    [gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]-[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]
    description
    [Pubmed|30782637,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|30782637], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|GlcR]: repression, [pubmed|30782637], in [regulon|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|GlcR regulon]
  • regulation

  • induced by phosphosugar stress [Pubmed|30782637]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A530 (ywpI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/530 NBRP B. subtilis, Japan]
  • BKE36300 ([gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCCCTCATTCCTTTTCT, downstream forward: _UP4_GATGAAGGAAAGGACTGACA
  • BKK36300 ([gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCCCTCATTCCTTTTCT, downstream forward: _UP4_GATGAAGGAAAGGACTGACA
  • References

  • 11491085,14762004,11948146,22383849,30782637