SubtiBank SubtiBank
yugP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yugP

unknown
locus
BSU_31310
pI
9.16
mw
24.55 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,217,496 3,218,173

    Expression and Regulation

    Operons

    genes
    [gene|55CDB094A8139B3273916193EEF6FC5996FD1C99|yuzI]-[gene|6FC2777AEF26F17F6908CA80459EE1E2523F275B|yugP]
    description
    [Pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [Pubmed|22383849]
    view in new tab

    genes
    [gene|6FC2777AEF26F17F6908CA80459EE1E2523F275B|yugP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A617 (yugP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/617 NBRP B. subtilis, Japan]
  • BKE31310 ([gene|6FC2777AEF26F17F6908CA80459EE1E2523F275B|yugP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATCATCCTTTG, downstream forward: _UP4_TAACGTTAAGGAGGTGGCCC
  • BKK31310 ([gene|6FC2777AEF26F17F6908CA80459EE1E2523F275B|yugP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATCATCCTTTG, downstream forward: _UP4_TAACGTTAAGGAGGTGGCCC